|
Position-specific scoring matrices
to search for repeated sequences
Strange interpolation in tandem heptameric repeat Nostoc
|
You've looked at this intron in many species of Nostoc -- they all contain a tandem repeat based on the unit AACTCTT. This one is different, though. In the middle of the repeat is interpolated a 24-bp sequence. How did that get there?
|
AACTCTTAACTCTT
GTACAGACGTGATTAATCGCGTCT
AACGATT
24-bp sequence within 7-mer repeat in intron of Nostoc
|
Transposons are known to hop around genomes, inserting themselves nearly at random, but transposons are at least several hundred nucleotides in length, in order to encode the enzyme that catalyzes the hopping. Is this a hitherto unknown transposable element somehow 40-times smaller than it should be?
You resolve to find out whether there are other copies of the element in the genome, as there might be if it were transposable. To do this, you take the sequence and compare it against the Nostoc genome.
You do this (do it) and find...
Back to main Scenario page back one page continue
|
