|
Position-specific scoring matrices
to search for repeated sequences
Tandem heptameric repeats in the genome of Nostoc
|
Many eukaryotic genomes are filled with microsatellites, typically tandem repeats of short stretches of DNA (e.g. CACACACA...). Nostoc's genome also has a high percentage of tandemly repeated sequences, and in this it differs markedly from other known bacterial genomes. However, the repeated sequences are not based on monomeric or dimeric units as in eukaryotes but almost invariably on specific families of 7-nucleotide units.
|
AGTGCTGAGTAGCTATAAGTG
TTGAGTTGAAGAAAGTTTTTC
ATTCAAAACTCAAAATTTCAA
ACTCAGAACTCAGGACTCAGA
CCTCAGAACTCAGAACTCAGG
ACTCAGAACTTAAAGTTAATG
Variations on ACTCAGA
in Nostoc genome
|
You're interested in an intron found in cyanobacterial genomes, because no other bacterial genome is known to possess introns, and within it you run across one of Nostocs many heptameric repeats. However, this one is remarkably different from any you've seen before.
Back to main Scenario page back one page continue
|
