|
Phage sequences in bacterial genomes
The truth behind Blast
Primer #2R is in the genome!
|
BLAST says that Primer #2R doesn't match any lengthy K12 sequence. PCR says it does. It's time to take matters into your own hands, so you sequence the K12 sequence that was amplified and compare its end (by eye, not BLAST) with Primer #2R. |
Primer #2R: GAAAAATCAGTTTTGCGCCG
K12 genome: GAAAAATCACTTTTGCGCCG
Comparison by eye of region from phage P2 (coords ~2288-2307) and the E. coli genome (coords 1779237-1779236). BLAST did not find this match.
|
What is going on? Never mind PCR, the K12/Primer #1R comparison certainly doesn't look any better than the K12/Primer #2R comparison, yet BLAST found the first easily and was stumped by the second.
You decide to give BLAST one more chance.
Back to main Scenario page back one page continue
|
