|
Phage sequences in bacterial genomes
The truth behind Blast
Quality control #2: Confirm BLAST results with PCR
|
You found that Primer #1R does match a K12 sequence (with one mismatch) and so must be discarded. But BLAST found no match in K12 DNA for Primer #2R. |
Primer #1R: AGAATTTTTTCAGTGACGAG
K12 genome: AGAATTTTTTCGGTGACGAG
BLAST comparison of region from phage P2 (coords ~2617-2598) and the E. coli genome (coords 2130756-2130775). |
Always the soul of caution, however, you are not content with a virtual result and want to confirm by experiment that Primer #2 is not present in the bacterial genome known to lack P2. Accordingly, you perform a PCR reaction with the primer sequences (plus another, Primer #3L, in opposite orientation, as required by PCR). No DNA fragment should be amplified by PCR because, as you just determined by BLAST, there are no binding sites in the K12 genome for Primer #1R.
Unfortunately, the PCR experiment disagrees: a ~3000 nucleotide band shows up on the gel. Where did that come from?
Back to main Scenario page back one page continue
|
