|
The origin of human genetic variability from
cross-species comparisons: The truth about Blast
Blast failure?
You check the sequence she sent with her message, and sure enough, it looks like she's right! Perhaps she's using a different version of the still incomplete chimp genome? |
RS1140646: AGCACCGCCGMGGACTCCAGC
45338084: AGCACCGCCGAGGACTCCAGC
By-eye comparison of human SNP RS1140646 to given sequence from chimpanzee chromosome 22. |
You ask for and get the sequence she has surrounding the supposed SNP hit. When you Blast it against your chimp sequence, you get an exact hit. So that's not the reason!
What is going on? The mysterious RS1140646 doesn't look any less similar by eye to chromosome 22 than does RS968436, let alone the RS1059610 (with two mismatches), yet Blast found the latter two easily and was stumped by the first.
Confess it -- you're shaken. But you decide to give Blast one more chance.
Back to main Scenario page back one page continue
|
