Virtual PCR: Blast contig ends against a Streptococcus genome

So, extract ends from all the contigs, download the genomic sequence of Streptococcus pyogenes, install Blast on your own computer, and Blast the ends against the genomic sequence. This is what you get:  ... and tens of megabytes of more of the same. The answers you seek are buried in this output. But it would take just as long to read through it as to do the 160,000 PCR reactions! How can you extract the wheat from the enormous amount of chaff? You need a way of automating the process of picking out the matches you want.

Score = 133 (26.0 bits), Expect = 4.6e-17 Positives = 67/107 (62%), Strand = Plus / Query: 1049 AAGCTAAAAAGA-CTGATGAGCGTTC || || |||| | | || || || Sbjct: 3314456 AATCTCAAAAAAGCAGAAGATACTTG Query: 1107 A-CAATCTGTTGCTGATT-TAGGAGT | | | | |||| | || Sbjct: 3314515 AGCTA-CAACA-CTGAATCTAACCAC

 

Back to main Scenario page      back one page