Introduction:
P2-related prophages have been found in a large variety of enteric bacteria. Comparative studies of the genomes of these phages have revealed numerous so-called "lysogenic conversion genes", which introduce new phenotypic properties to the bacterial host. Some of these genes are known virulence factors. The long-term goal of this project is to analyze pathogenic E. coli strains for the presence of P2-related prophages and to determine whether genes carried on these prophages contribute to the virulence of these bacteria. These bacteria are responsible for serious illness (diarrhea) and even death in several developing nations. Developing a better understanding of these strains and a possible connection to P2-related phages will help to control these virulent strains.

In this study we plan to screen a collection of phlyogenetically classified enteroaggregative E. coli strains (Czeczulin, J.R. et al. 1999. Infect Immun. 67:2692-2699) for the presence of P2-related prophages and then determine what lysogenic conversion genes are carried by these prophages.

In the first part of this project (summer 2003, see reference 3), PCR primers were designed to target the most highly conserved region in the P2-related phages—the capsid gene cluster. Using NCBI’s tBlastn and Blastn, the genomes of P2-related phages and prophages in Enterobacteriaceae were compared in order to identify sequences suitable for PCR primers. Two stretches of twenty-three nucleotides from the P gene (in the capsid gene cluster) were used. The sequences were located about 180 basepairs away from each another. The reverse complement of the second sequence was used. Here are the alignments (the primer is the middle section):

P2-----------------aaaaa taaaacgtcgcgccaatctggcg ggatttcaggat
L-413C-------------aaaaa taaaacgtcgcgccaatctggcg ggatttcaggat
186----------------aaaaa tagaacgtcgcgccaatctggcg ggatttgagaat
Colipahge186-------aaaaa tagaacgtcgcgccaatctggcg ggatttgagaat
Salmonella---------caaaa taaaacgtggcgccaatctggcg cgacttgagcag
Salmonella---------caaaa taaaacgtggcgccaatctggcg cgacttgagcag
Salmonella---------caaaa taaaacgtggcaccaatctggcg cgacttgagcag
Salmonella---------caaag taaaaggtcgcgccgatctggcg tgacttcagcag
Salmonella---------caaag taaaaggtcgcgccgatctggcg tgacttcagcag
E. Coli------------caaag taaaaggtcgcgccgatctggcg tgacttcagcag

P2---------------------g cctttgttacggttagcgacgtt cggatta
L-413C-----------------g cctttgttgcggttagcgacgtt cggatta
186--------------------a cccttgttgcggttggcgacgtt ggggtta
Coliphage186-----------a cccttgttgcggttggcgacgtt ggggtta
Salmonella-------------a cctttgttacggttggctacttt cgggttt
Salmonella-------------a cctttgttacggttggctacttt cgggttt
Salmonella-------------g cctttgttgcggttggcgacgtt agggttt
Salmonella-------------g cctttgttgcggttggcgacgtt agggttt
Salmonella-------------g cctttgttgcggttggcgacgtt agggttt
E. Coli----------------g cccttgttgcggttggcgacgtt aggattt

RMM1 5’ TAA AAC GTC GCG CCA ATC TGG CG 3’
RRM2 5’ AAC GTC GCY AAC CGY AAC AAA GG 3’
These primers were ordered from Integrated DNA Technologies, Inc, and used to screen a collection of twenty-six strains of phlyogenetically classified enteroaggregative E. coli strains (Czeczulin). The PCR products were then run on a 1.4% agarose gel. Fifteen of the strains had a positive PCR product that was about 180bp in size. Each gel contained a 100bp ladder, a positive control (C-1920, containing Wphi), and a negative control (PCR water was used instead of a DNA template). This is the gel from the second set of PCR products.

The following diagram is a modified version of a diagram found in the Czeczulin paper. The green spots mark strains that were screened and did not have a positive PCR product. The red spots signify strains that had positive PCR products.